"नये भारत का नया Tender Portal"
Request a call back

GeM Registration #35610475

Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5

  • Sector: Education And Research Institutes
  • Location: Uttaranchal

We provide GeM Registration for Aroor Gp 53/22 High School Chalara Road, Mullayil Mukkambathu Road Renovation In Ward 5

  • Get complete Support to submit Tender Bid.
  • Support in Bidding Online and upload your Bids on the department Portal.
  • Support in documentation and Vendor Registration.
  • Checking Eligibility Criteria
  • Support in Technical as well as Financial Bid.
  • Tender Document.

For more details Kindly fill up the form and our executive will get in touch with you or Call us :- 916351913337 .

GeM Registration