"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders for potassium ferricyanide

Total 56 tenders found
#TBR: 35694585 Live

Crude Oil/natural Gas/mineral Fuels

  • Maharashtra
  • Due On: 10 Nov, 2025 (4 Days Left)

Gem Bids For Hydrochloric Acid Ampules 0.1 N , Hydrochloric Acid Ampules 1n , Sulphuric Acid Ampules 1n , Sulphuric Acid Ampules 0.1 N , Iodine Ampoules 0.1 N , Edta Ampoules 0.1 N , Sodium Hydroxide Ampoules 1n , Sodium Hydroxide Ampoules 0.1 N , Silver Nitrate Ampoules 0.1 N , Ammonia Solution , Ammonium Acetate , Ammonium Ferous Sulphate , Aluminium Oxide For Column Chromatography , Ammonium Chloride , Barium Chloride , Barium Diphenyl Amine Sulphonate Indicator , Calcium Chloride Dihydrate , Carbon Disulphide , Calcium Acetate Anhydrous , Copper Sulphate Pentahydrate , Cuprous Iodide , Edta Disodium Salt , Ferroin Indicatior , Glacial Acetic Acid , Hydrochloric Acid , Hydrofluoric Acid , Hydroxylamine Hydrochloride , Hydrazin Sulphate , Karl Fischer Reagent , Iso Octane , Iso Propyl Alcohol , Mercuric Chloride , Patton And Readers Indicator , Potassium Ferricyanide , Potassium Hydroxide Pellets , Potassium Iodide , Phenyl Isothiocynate , Pyridine Di Carboxylic Acid , Silver Nitrate , Silica Gel 60-120 Mesh For Column Chromatography , Silicon Grease , Sodium Chloride , Sodium Hydroxide Pallet , Sulphuric Acid , Starch , Thymol Blue Indicator , Quinoline , Zinc Granulated 99.5 , Dithizone Indicator

Ref. Document
View Tender
#TBR: 35645943 Closed

Survey Work

  • Maharashtra
  • Due On: 29 Oct, 2025 (0 Days Left)

Supply Of Laboratory Chemicals - Acetic Acid, Glacial (2.5l) Pack Alizarin Red S (5g) Pack Ascorbic Acid (100g) Pack Aluminium Potassium Sulphate (500g) Pack Ammonium Acetate (500g) Pack Ammonium Chloride (500g) Pack Ammonium Hydroxide (2500 Ml) Pack Ammonium Purpurate/ Muroxide (25 G) Pack Arsenic Trioxide (100g) Pack Barium Chloride (500g) Pack Bromocresol Green Indicator (25 G) Pack Boric Acid (500g) Pack Calcium Chloride (fused) (500g) Pack Calcium Chloride (500g) Pack Ethylene Diamine Tetra-acetic Acid (di-sodium Edta) (250g) Pack Erichromeblackt (25g) Pack Eriochromecyanine:r (25g) Pack Ferrous Ammonium Sulphate (500g) Pack Hydrochloric Acid,conc (2.5l) Pack Hydroxyl Amine Hydrochloride (100g) Pack Hydrogen Peroxide (500ml) Pack Lead Acetate (500g) Pack Methyl Orange Indicator/ Methyl Red Indicator (125 Ml) Pack Phenolphthalein Indicator/ P&r Indicator (125 Ml) Pack Potassium Hydroxide (500g) Pack 1-10, Phenanthroline, Monohydrate (10 G) Pack Potassium Permanganate (500g) Pack Potassium Iodide (500g) Pack Potassium Chromate (500g) Pack Potassium Hydrogen Phthalate (500g) Pack Stannous Chloride (100g) Pack Sodium Hydroxide (500g) Pack Silver Nitrate (100g) Pack Sodium Acetate (250g) Pack Sodium Thiosulphate (500g) Pack Starch (soluble) (500g) Pack Sodium Fluoride (anhydrous) (500g) Pack Sodium Arsenate (100g) Pack Spadns (5gm) Pack Zirconyl Oxy Chloride, Octo Hydrate (100g) Pack Sodium Sulphate (anhydrous) (500g) Pack Sulphuric Acid, Conc (2.5l) Pack Sodium Chloride (500g) Pack Potassium Dichromate (500g) Pack Calcium Carbonate (anhydrous) (500g) Pack Phenol, White (250g) Pack Potassium Nitrate (500g) Pack Sodium Sulphate, (500g) Pack Ph Indicator Paper, Range 2-14 With Comparatr (10 Bkts) Pack Macconkey Broth, Dehydrated (hi-media) (500gm) Pack Total Ionic Strength Adjustment Bu?er (tisab) (500ml) Pack Oxalic Acid (500g) Pack Silver Sulphate (25g) Pack Sodium Arsenite (100g) Pack Potassium Dihydrogen Phosphate (500g) Pack Ammonium Molybdate (100g) Pack Nitric Acid (2.5l) Pack Anhydrous Potassium Nitrate (500g) Pack Sulphanilamide (100g) Pack Sodium Nitrite (500g) Pack Sodium Oxalate (500g) Pack Sodium Bicarbonate (500g) Pack Sodium Borate Decahydrate (500g) Pack Sodium Tetraborate (500g) Pack Glycerol (500ml) Pack Potassium Chloride (500g) Pack Carmine Reagent (25gm) Pack Ammonium Solution (500ml) Pack Mercury Sulfate (250g) Pack Sodium Bisulphate (100g) Pack Sodium Acetate (500g) Pack Zinc Metal (500g) Pack Potassium Ferricyanide (500g) Pack Methanol (500ml) Pack Phosphoric Acid (100ml) Pack Anhydrous Potassium Bi-iodate (100g) Pack Chloroform (500ml) Pack Anhydrous Potassium Bromide (500g) Pack Methylene Blue (25g) Pack Sodium Phosphate, Mono Basic Monohydrate (500g) Pack N-hexane (500ml) Pack Methyl Red Indicator (100 Ml) Pack M-fc Agar (500gm) Pack Emb Agar (500gm) Pack Macconkey Agar (500gm) Pack Lactose Lauryl Tryptose Broth (500gm) Pack Brilliant Green Bile Growth (500gm) Pack E.c. Broth (500gm) Pack Luaryl Sulphate Broth (500gm) Pack Phosphoric Acid 5% H3po4 (500ml) Pack Anhydrous Kbro3 (500gm) Pack Sodium Arsenite (naaso2) (100gm) Pack Urea (500gm) Pack Anhydrous Sodium Sulphate (500gm) Pack Ccl4 (500ml) Pack K2hpo4 (500gm) Pack Hydroxyl Amine Sulphate (1 Kg) Pack Sodium Nitroprusside (100gm) Pack Phosphate Bu?er (500ml) Pack Ferro In Indicator (100ml) Pack Sodium Carbonate (500 Gm) Pack Chromogenic Coliform Agar (cca ) For Water Analysis (100 Gm) Pack Buffered Glucose Broth /mr Vp Broth (100 Gm) Pack Tryptone/peptone Water (500 Gm) Pack Kovacs Reagent (100 Ml) Pack Oxidase Disc (1 Vl) Pack Gram Staining Kit (1 Kit) Pack Parrafin Oil (500 Ml) Pack Geobacillus Stearothermophoilus - Biological Indicator Strips (1 X 25 No.) Pack Steam Indiacator Tape (1 No.) Pack

Ref. Document
View Tender
#TBR: 35614830 Closed

Health Services/equipments

  • Mizoram
  • Due On: 03 Nov, 2025 (0 Days Left)

Gem Bids For Pharmacy, Eudragit, Phloroglucinol Ar, Potassium Phosphate, Phosphate Buffer, Phosphate Buffer Saline, Phosphateglycol, Phosphatidylcholine, P Nitrophenyl Glucopyranoside, Poloxamer, Poly Vinyl Pyrrolidone, Polyethylene Glycol, Potassium Chloride, Potassium Ferricyanide, Potassiumhydroxide, Potassium Iodobismuth, Potassium Mercuriciodide, Potassium Phosphate Buffer, Potassium Phosphatemonobasic, Potassium Sodium Tartrate, Potato Dextroseagar, Povidone Iodine Ointment, Propyl Paraben, Quercetin, Safranin, Serum Glutamic Oxaloacetictransaminase, Serum Glutamic Pyruvic Transaminase, Silica Gel, Silymarin, Sodium Benzoate, Sodium Citrate, Sodium Iodide, Sodium Nitroprusside, Sodium Phosphate, Sodium Phosphate Buffer, Sodium Phosphate Dibasic, Sodium Starch Glycolate, Span Diagnostic Kit, Starchpowder, Talc, Tannic Acid, Tertiary Butyl Alcohol, Topfersreagent, Tptz, Trifluoroacetic Acid, Triphenyltetrazolium, Tripyridyltriazine, Tween, Vitamin, Wagners Reagent, Water For Hplc, A Amylase, A Glucosidase

10.00 Lacs
View Tender
#TBR: 35202733 Closed

Education And Research Institutes

  • Orissa
  • Due On: 12 Sep, 2025 (0 Days Left)

Gem Bids For Chemical, 4 Aminoantipyrine Ampyrone, Ethyl Alcohol, Acetic Acidch3cooh, Acetone, Ammonia Solution Ammoniumhydroxide Concentrated, Ammonium Chloride, Ammoniumferrous Sulphate, Ammonium Metavanadate, Ammoniummolybdate Tetrahydrate, Barium Chloride, Boric Acid, Bromocresol Green Bcg, Calcium Chloride Fused, Carmine, Chloroform, Cobalt Ii Chloride Hexahydrate, Concentratednitric Acid, Copper Ii Sulfate, Curcumin Turmeric Yellow, Dipotassium Hydrogen Ortho Phosphate, Di Sodium Hydrogenphosphate, Disodium Salt Edta, Edta Magnesiumdisodium Complex Edta Mg, Eriochrome Black T, Ethyleneglycol, Ferric Chloride Anhydrous, Ferric Chloridehexahydrate, Ferroin Solution, Formaldehyde Solution, Hydrochloric Acid, Hydroxylamine Hydrochloride, Iodineresublimed, L-glutamic Acid, Magnesium Chloridehexahydrate Extrapure, Magnesium Sulphate Heptahydrate, Mercuric Chloride, Mercuric Sulphate, Methanol, Methylorange, Methyl Red, Murexide Ammonium Purpurate, N 1naphthyl Ethylenediamine Dihydrochloride Neda, N Ndiethyl P Phenylenediamine Sulphate Salt, N Hexane, Orthophosphoric Acid, Phenol, Phenolphthalein Indicator 1percent Soln In Ethanol, Potassium Chloride, Potassiumchromate, Potassium Dichromate, Potassium Dihydrogenphosphate, Potassium Ferricyanide, Potassium Hydrogenpthalate, Potassium Iodate, Potassium Iodide, Potassiumnitrate, Potassium Sulphate, Silica Gel, Silica Gel Blue, Silver Nitrate, Silver Sulphate, Sodium Acetate Anhydrous, Sodium Acetate Trihydrate, Sodium Arsenite, Sodium Azide, Sodium Borohydride Powder, Sodium Carbonate, Sodiumchloride, Sodium Hydroxide Pellets, Sodium Nitroprusside, Sodium Sulphate Anhydrous, Sodium Thiosulphatepentahydrate, Spadns, Starch Soluble, Sulphamic Acid, Sulphanilamide, Sulphuric Acid  /bid Number: Gem/2025/b/6519051* /dated: 22-08-2025  & & / Bid Document1 / 60

3.11 Lacs
View Tender
#TBR: 35148166 Closed

Education And Research Institutes

  • Rajasthan
  • Due On: 04 Sep, 2025 (0 Days Left)

Gem bids for Srl, Potassium Ferricyanide Extrapure Ar 98 Percentage, Potassium Ferrocyanide Extrapure Ar 99 Percentage, Sodium Phosphate Dibasic Anhydrous For Molecular Biology99.5 Percentage, Sodium Phosphate Monobasic Anhydrousfor Molecular Biology 99 Percentage, Potassiumpermaganate Sq 500 G, Formaldehyde 37 41 Percentagewv Sq 500 Ml

Ref. Document
View Tender
#TBR: 34427551 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 15 May, 2025 (0 Days Left)

Gem Bids For 2 4- Dichlorophenoxyacetic Acid , 2 2-diphenyl-1- Picrylhydrazyl , Mitra Medium , Murashige And Skoog Medium , Methanol , Hexane , Chloroform , 2 2-azino-bis 3- Ethylbenzothiazoline-6-sulfonic Acid , Rutin , Chlorogenic Acid , Sodium Phosphate Buffer , Potassium Ferricyanide , Trichloroacetic Acid , 3 5- Dinitrosalicylic Acid Dnsa , Laurylpentachlorphenate Lpca , Formalin

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34132819 Closed

Education And Research Institutes

  • Uttar Pradesh
  • Due On: 20 Mar, 2025 (0 Days Left)

Supply of 1 2 Dichloroethane extrapure 99 percent , 2 3 5 Triiodobenzoic Acid extrapure 98 percent , 2 4 Dinitrophenol 97 percent Indicator , 2 4 Dinitrophenylhydrazine extrapure AR , 3 3 Diaminobenzidine DAB pure 98 percent , 5 5inch Dithiobis 2 Nitro Benzoic Acid extrapure , 5 Sulphosalicylic Acid extrapure 99 percent , Acacia Powder , Acetic Acid Glacial extrapure 99 point5 percent , Acetone pure 99 percent , Acid Fuchsin , Activated Charcoal , Agarose , Albumin Bovine , Ammonia Soln Abt 25 percent Sp Gr 0 point 91 , Ammonium Ferrous Sulphate , Ammonium Molybdate Tetrahydrate , Ammonium Sulphate , Antimony Potassium Tartrate Hemihydrate , Barium Chloride , Bradford Reagent for Proteins , Calcium Chloride Dihydrate extrapure , Calcium Hydrogen Orthophosphate Dihydrate , Calcium Nitrate Tetrahydrate 99 percent , Charcoal Activated 280 extrapure , Chlorocholine Chloride CCC extrapure , Choline chloride extra pure , Cupric Oxide Nanopowder , Dextrose extrapure , Diphenyl amine AR , Dithioerythritol DTE extrapure 99 percent , D Maltose , EDTA Free Acid extrapure 99 percent , Eosin Yellow water soluble , Ethylene di amine tetra acetic Acid Ferric Sodium Salt , Ethylene Glycol pure 98 percent , Evans Blue , Ferric Nitrate Nonahydrate extrapure AR , Ferroin SolnAr , Ferrous Ferric Oxide Nanopowder , Gibberellic Acid GA3 90 percent , Glutathione Oxidized GSSG extrapure , Glycine Betaine Betaine anhydrous , Guaiacol extrapure 99 percent , Hydrochloric Acid 35 38 percent 1 point 18 , Hydrogen Peroxide Soln 20 Volumes 6 percent , Indole 3 Acetic Acid IAA , Iodine Resublimed , Kinetin extrapure , L Tryptophan , L Ascorbic Acid extrapure , Lead II Acetate Trihydrate pure 99 percent , Magnesium Chloride Anhydrous extrapure , Magnesium Sulphate Heptahydrate , Malachite Green Oxalate , Mercuric Iodide Red 99 percent , Mercuric Thiocyanate pure 98 percent , Methanol pure 99 percent , Methyl Orange pH Indicator , Methyl Red Acs Reag , Methyl salicylate , Orange G , Orthophosphoric Acid Abt 85 percent , Paraffin Wax , Perchloric Acid 60 percent , Phenol Crystalline extrapure AR 99 point 5 percent , Phenolphthalein Soln pH Indicator , Polyethyleneglycol 6000 PEG 6000 , Potassium Chloride , Potassium Dichromate , Potassium Ferricyanide , Potassium Ferrocyanide extrapure , Potassium Hydroxide pellets extrapure , Potassium Iodide pure 99 percent , Potassium Permanganate extrapure 99 percent , Potassium Phosphate Dibasic Anhydrous , Potassium Sulphate extrapure 99 percent , Riboflavin pure 98 percent , Salicylic Acid pure 99 percent , Schiff s Reagent , Selenium Metal Powder , Silicon di oxide nanopowder , Silver Sulphate Purified 98 point5 percent , Sodium Arsenate , Sodium Azideextrapure , Sodium Bicarbonate extrapure , Sodium Chloride extrapure , Sodium Cobaltinitrite , Sodium Fluoride , Sodium Hydrogen Carbonate , Sodium Meta Silicate , Sodium Molybdate Pure 98 102 percent , Sodium Potassium Tartrate Tetrahydrate , Sodium Silicate Meta Nonahydrate , Sodium Sulphate Anhydrous extrapure , Sodium Thiosulphate Pentahydrate , Stannous Chloride , Starch Soluble extrapure , Thiazolyl Blue Tetrazolium Bromide MTT , Thiourea extrapure AR 99 percent , Titanium Dioxide extrapure 98 percent , Toludine blue , Toluene pure 99 percent , Tris Acetate Buffer , Zinc Metal Powder , Zinc Acetate Dihydrate extrapure 98 point5 percent , Zinc Oxide Nanopowder , Petroleum ether , Tris Buffer

Ref. Document
View Tender
#TBR: 34099580 Closed

Education And Research Institutes

  • Delhi
  • Due On: 14 Mar, 2025 (0 Days Left)

Supply of Ammonium Sulphate GR 500gm , Anthrone AR 100gm , Ammonium Chloride 99 500gm , Ammonium acetate , L Ascorbic Acid AR 100gm , Bromocresol Green 100 gm , Boric acid 5 kg , Citric Acid Monohydrate extrapure 500gm , Calcium carbonate precipitated 500gm , Celite Acid Washed 1kg , Calcium chloride 500gm , Dextrose anhydrous GR 500gm , Folin and ciocalteu s phenol reagent 500ml , Ferric Chloride 500gm , Gallic Acid , Iodine 500gm , Lithium Sulphate Monohydra te extrapure 500gm , Methyl Red 100gm , Magnesium chloride hexahydrate GR 500gm , M Phosphoric Acid 500gm , Phenol carbolic acid 100ml , Potassium Iodide extrapure AR 100gm , Potassium Sulphate AR Grade 500gm , Phosphoric Acid AR grade 500ml , Phosphoric Acid HPLC grade 500ml , Potassium Chloride GR 500gm , Sodium Hydroxide Pellets extrapure , Sodium carbonate monohydrate AR 500gm , Sodium Phosphate Dibasic Dihydrate 500gm , Sodium Phosphate Monobasic Dihydrate extrapure AR 500gm , Sodium Acetate Anhydrous 500gm , Sodium Carbonate Anhydrous 500gm , TPTZ extrapure AR 5gm , Trichloroacetic acid 500gm , DPPH 2 2 Diphe nyl 1 picryl hydrazy 5gm , Methanol AR 2500ml , Acetone AR 2500ml , Sulfuric Acid 2500ml , Nitric Acid 2500 ml , Petroleum Ether 40 60 AR Extra Pure 2500 ml , CHLOROFORM 2500ml , Hydrogen Peroxide , Hydrochloric acid 2500ml , Diethyl Ether 2500ml , Acetonitrile 2500ml HPLC , Dichlorome thane 2500 ml HPLC , Labolene Washing Solution 5litre , Ninhydrin 25g , Nitroblue tetrazolium chloride 1g , Sulphosali cyclic acid 500g , Methanol AR 1000ml , Polyethelyn e glycol 6000 500g , Dinitrosalicylic acid , Sodium potassium tartarate 500g , Starch 500g , KC1O3 Potassium Chlorate 1kg , NaOCl 500 ml , Filter paper Grade no 1 12.5CM p k of 100pcs , Phenol 500gm , Catechol 100gm , Hydroquinon 100gm , P hydroxyb enzaldehyde 100gm , P hydroxyp henylacetal dehyde 100gm , P hydroxybenzoic acid 100gm , Cinnamic acid 250gm , P hydroxyp henylacetic acid 25gm , Protocatec huicacid 100mg , Vanilla acid , Gallic acid 25mg , Caffeic acid 5mg , Ferulic acid 1gm , Syringic acid 25gm , Kaempferol 25mg , Formicacid HPLC 100 ml , Methanol LC grade 2point5L , Ethanol LC grade 2point5 L , Potassium ferricyanide 500gm , FeCl3 500gm , Guaiacol 250gm , Dibasic Potassium Phosphate 500gm , Potassium phosphate monobasic 500gm , Sodium carbonate 500gm , L methionine 100gm , NBT Nitro blue tetrazolium 100mg , Riboflavin 25gm , L Phenylalanine 100gm , Trans cinn amic acid TCA 250gm

Ref. Document
View Tender
#TBR: 34082386 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 11 Mar, 2025 (0 Days Left)

Supply of FCP reagent , Gallic acid , DPPH , Ethanol , Cur Std , CurPCL , Acetone , LiCl , LiNO3 , SBR binder , 1-10 Phen C12H8N2 , Iron trichloride FeCl3 , CoCl2 , Thorin indicator , Lithium hydroxide LiOH.H2O , Potassium periodate KIO4 , Polyvinylidene fluoride binder PVDF , Lithium nitride Li3N , Graphite , Manganese chloride MnCl2 , Nickle chloride NiCl2 , Cobalt nitrate CoNO32 , Manganese nitrate MnN2O6 , Nickle nitrate Ni,NO32 , Methyl acetate , Methyl carbonate , Di-methyl carbonate , Potassium ferricyanide , Neutral red , Disodium anthraquinone-2.6-disulfonate , Platinum oxide , Vitamin K1 Ready Made Solution , TBATFB NBu4BF4 , Sulfuric Acid , NaOH , Boric Acid , Copper or Selenium Catalyst , Methyl red indicator , HCLO4 , NH4 6M07024.4H20 , TARTARIC ACID , Na2SO3 , C8H10K2O15Sb2 , ASCORBIC ACID , H2O2 , N, C, K, NH4 M , F-, Cl-, NO3-, PO4-, SO4-, Br- , Filter paper220nmdi25mm , Syringes 10 ml , Al Heavy duty foil , L.-cysteine , Elec PolKit pk 4 , Arsenic oxide , Chromium chloride , Potassium dichromate , Graphene oxide , Carbon nanotube , Nano diamonds , Carbon nanofibers , C3H5BrClN3 , Glycerol , Ethylene glycol , Diethylene glycol , Triethylene glycol , Ethylene diamine , bi no3 3 5h2o , Na2S-H2O , Citric acid , 5-furouracil , Para-aminophenol , Flutamide , Urea , Thioacetamide , Tetracycline , Metronidazole , Thiophene , Pyrrole , 2 6 ndca

Ref. Document
View Tender
Download Document