"नये भारत का नया Tender Portal"
Gem Bids For Chemicals, 2 Thiobarbituric Acid 500gm, Potassium Phosphatemonobasic 500gm, Heparin Sodium Salt 1gm, Tween 20500ml, Sodium Dodecyl Sulphate 1 Kg, Coomassie Brilliantblue G 250 25gm, Meta Phosphoric Acid 500gm, 2mercaptoethanol 1ml, Ethanol 500ml, Petroleum Ether 2.5l, Sulphuric Acid 500ml, Acetonitrile 2.5l, N N N Ntetramethyl Ethylenediamine Temed 500ml, Ammoniumpersulphate 500gm, Hydrochloric Acid 500ml, 2 7dichlorofluorescein Diacetate 100mg, Trichloroacetic Acid250gm
Gem Bids For 272025, Sample Bags, Ldpe Non Autoclavable, 100 Micron Thickness9 133l, Sample Bags, Ldpe Non Autoclavable, 100 Micronthickness 5 8 0.5l, Pasteur Pipette, Ldpe, 3 Ml Capacity, Sterile Sample Container, Pp With Hdpe Closure 100 Mlcapacity, Formalin 1 Lt Bottel, Cynocobolime 250mg, Sodium Nitrate 50 Kg, Edta 500g, Sodium Silicate 1 Kg, Activated Charcoal 500, Epinephrine, Dntb Ellmansreagent, Reduced Glutathione Gsh, Glutathionereductase, Tbars Thiobarbituric Acid, Butylatedhydroxytoluene
Gem Bids For 272025, Sample Bags, Ldpe Non Autoclavable, 100 Micron Thickness9 133l, Sample Bags, Ldpe Non Autoclavable, 100 Micronthickness 5 8 0.5l, Pasteur Pipette, Ldpe, 3 Ml Capacity, Sterile Sample Container, Pp With Hdpe Closure 100 Mlcapacity, Formalin 1 Lt Bottel, Cynocobolime 250mg, Sodium Nitrate 50 Kg, Edta 500g, Sodium Silicate 1 Kg, Activated Charcoal 500, Epinephrine, Dntb Ellmansreagent, Reduced Glutathione Gsh, Glutathionereductase, Tbars Thiobarbituric Acid, Butylatedhydroxytoluene
Gem Bids For Chemcials , Trichloroacetic Acid , 2 Thiobarbituric Acid , Potassium Phosphate Monobasic , Heparin Sodium Salt , Tween 20 , Hydrochloric Acid , Sodium Dodecyl Sulphate , Coomassie Brilliant Blue G 250 , Meta Phosphoric Acid , Mercaptoethanol , Ethanol , Petroleum Ether , Sulphuric Acid , Acetonitrile , N N N N Tetramethyl Ethylenediamine Temed , Ammonium Persulphate , 2 7 Dichlorofluorescein Diacetate
Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G
Supply Of Mops Buffer 25g , Triton X 100 100ml , Beta 2 Mercaptoethanol 100ml , Integrin Beta1 Or Itg B1 A4 Antibody 200ug Per Ml , Dnase I 100mg , Rnase Zap 250ml , Acetone Emplura 500ml , Trolox 500mg , Isoflurane 250ml , Crotaline 1gm , Urethane 100gm , Protease Inhibitor Cocktail 100x 1ml , Carboxy Methyl Cellulose Sodium Salt 500gm , Acrylamide 1kg , Copper Sulphatehexahydrate 500gm , Exo Rneasy Midi Kit 50reactions , Molecular Grade Ethanol 500ml , Paraformaldehyde 500gm , Evans Blue 10gm , Depc Treated Water 500ml , Formamide 100ml , Temed 100ml , Nitrocellulose Membrane Roll , Skim Milk Powder 500gm , Dpbs,nocalcium,no Magnesium 500ml , Sodiumphosphate, Monobasic,monohydrate 500gm , Meta Phosphoric Acid 100gm , Cd63 Antibody 200ug Per Ml , Dtnb 5gm , Rna Later 100ml , Ripa Buffer 10x 100ml , Reverse Transcription Kit 50reactios , Lys C Endoproteinase,ms Grade 20ug , Ecl 2x250ml , Cd9 Antibody 200ug Per Ml , Cd31 Or Pecam 1 Antibody 100ug , Cd41 Antibody Or Integrin Alpha 2b Antibody 100ug Per Ml , Alpha Actinin 4 Antibody 200ug Per Ml , Calnexin Recombinant Rabbit Monoclonal Antibody 100ul , Endothelin 1 Monoclonal Antibody 100ul , Epcam Polyclonal Antibody 100ug , Rneasy Mini Kit 50reactions , Goat Anti Rat Igg H And L Secondary Antibody 1ml , Bca Protein Assay Kits 100 Reactions , Goatanti Rat Igg H And L Secondary Antibody,hrp 1ml , Goat Anti Human Igg Secondary Antibody, Hrp 1ml , Epas 1 Or Hif 2 Alpha Antibody 200ug Per Ml , Goat Anti Humanigg H And L Secondaryantibody 1mg , Collagenase D 100mg , Rat Sod Elisa Kit 96well , Rat Ace Elisa Kit 96well , Glutathione Peroxidase Assay Kit 480tests , Rna Blood Mini Kit 50reactions , Human Nox4 Nadph Oxidase 4 Elisa Kit 96well , Rat Et1 Elisa Kit 96well , Rat Xanthine Oxidase Elisa Kit 96well , Apob Antibody 200ug , Rat Renin Elisa Kit 96well , Anti Hsp 90 Antibody 100ug , Quercetin 10gm , Sample Buffer Laemmli 2xconcentrate Pack Of 10 Vials , Sequencing Grade Modified Trypsin 5 X20ug , Formicacid 98 To 100percent 50ml , Nadh, Disodium Salt 1gm , Ethanol 500ml , 2 Thiobarbituric Acid Analytical Reagent 99percent 100gm , Protein Dual Colour Standard 500ul , Hif1a Antibody 200ug Per Ml , Beta Tubulin Antibody 200ug Per Ml , Sybr Green Pcr Kit 200reactions
Supply Of 2-propanol Emplura- 1.94524.0521 -1lt Merck , 2- Thiobarbituric Acid -t5500- 500g Sigma , Acetic Acid - 61784325001730 -2.5l Merck , Acetocarmine, Hi-ar Grm4942-100ml Himedia , Acetone Emplura -1.94500.2521 -2.5 Lit Merck , Aceto-orcein , Agar Powder , Bacteriological -grm026 -500g Himedia , Agarose - Mb094 - 100g Himedia , Agarose Low Melting Point , Alkali Azide , Ammonia Buffer , Ammonia Solution 25 Emplura 500ml 1.93500.0521 Merck , Ammonium Chloride-emplura - 1.93621.0521 500g Merck , Ammonium Persulphate - Mb003 -500g Himedia , Ascorbic Acid , Benzene Emplura 500 Ml-1.01782.0521 Merck , Borax Carmine S003-125ml Himedia , Bromophenol Blue, Practical Gr. - Grm914 -25g Hm , Buffer For Restriction Enzymes , Calcium Choride Dihydrate -1.93633.0521 500g Merck , Carnoys Fluid , Centrifuge Tube 2ml Pk.500pc 500020 Tarsons , Chloroform Emplura 1.94506.0521 -500ml Merck , Colchicine - Pct1302 -1g Himedia , Coloured Stacking Gel Buffer - Ml208-200r Himedia , Copper Ii Oxide Grm732-500g Himedia , Copper Ii Sulfate Emplura -1.93616.0521 500g Merck , D- Glucose - 1.94925.0521 500gm Merck , Dishes, Culture, Petri -3160072 -80x17mm Borosil , Di-sodium Hydrogen Phosphate 1.93609.0521 500g Merck , Dmso Dimethyl Sulfoxide , Dpx Mountant 250ml - 61803502501730 Merck , Dulbeccos Phosphate Buffered Saline , Edta Ethylenediaminetetraacetic Acid , Eriochrome Black T-25g. Emparta 1.93320.0026 Merck , Ethidium Bromide , Fehlings Solution A 250-ml-61779705001730 Merck , Fehlings Solution B 250ml 61779705001730 Merck , Ferrous Sulphate Grm1377-250gm Himedia , Fetal Bovine Serum Fbs , Filter Paper Whatman - Gr-1 -125mm 1001-125-100pk , Folin Ciocalteus -rm10822 -250gm Himedia , Formaldehyde Solution Min. 37 Emplura 5lit
Supply of Sucrose , Cleri Gel , 6-BAP , IBA , a-Naphthaleneacetic acid Bracket NAA Bracket , L-Ascorbic Acid , Phloroglucinol , Kinetin , Thidiazuron Bracket TDZ Bracket , Murashige and Skoog Macroelements , Murashige and Skoog plant salt mixture , Woody Plant Medium , Autoclave tape , Bluple Nitrile Examination Gloves, Medium Size , Marcuric chloride , 2-Propanol, Hi-LR , Surgical Blade Bracket Twelve Number Bracket , Surgical Blade Bracket Eleven Number bracket , Forcep Pointed Bracket eight inch bracket , Freeze Tag , Syringe-driven Filters size zero point twenty two , Agar , Wash bottle , Para Film , Buffer capsule PH four point zero , Buffer capsule PH seven point zero , Buffer capsule PH nine point zero , Stainless Steel Scalpel Holder Number four , Dimethyl Sulphoxide Bracket DMSO bracket , Acetone for Synthesis , Methanol for Synthesis , Thiobarbituric Acid AR , Trichloro Acetic Acid AR slash ACS , Two comma four comma six tri bracket two Pyridyl bracket one comma three comma five Triazine AR , Perchloric Acid twenty percent , Folin and Ciocalteu s Phenol Reagent AR , Sodium Carbonate Bracket Anhydrous bracket AR , Gibberellic Acid Bracket GA3 Bracket , Indole Three Butyric Acid Bracket IBA bracket , One Naphthalene Acetic Acid , Acetic Acid, Glacial , Sulphuric Acid AR , Ethanol ultra pure ninety nine point ninety nine percent , Petroleum Ether AR , Two comma six Di Tert four Methyl Phenol Bracket see Butylated Hydroxy Toluene Bracket , Acetic Acid , Sulphosalicylic Acid AR , Orthophosphoric Acid , Ninhydrin , Two comma four Dinitro Phenyl Hydrazine AR , Thiourea AR , Potassium Dihydrogen Phosphate , di-Potassium Hydrogen Phosphate , Ascorbic Acid , Glutathione Oxidized , Five comma five Dithio Bis Extra Pure , Tris bracket Hydroxy Methyl bracket Amino Methane
Supply of MTT, 1g , Mueller Hinton Agar, M173-500G , Mueller Hinton Broth M391-500G , Taq DNA Polymetase ,recombinant, 5x500U , dNTP Set 100 mM Solutions, 4x0.25 ml , RevertAid Reverse Transcriptase, 5 x 10000 U , Glass Slides, Ground Edges, Plain 76 mm x 26 mm , 10ml Serological Pipettes Individually packed Sterile ,orange , 25ml Serological Pipettes Individually packed Sterile ,red , 90X16PS, Gamma Sterile, Fully Stackable Lid Individual Peal off 460 , Costar 96 Well Clear Flat Bottom, Polystyrene, Tissue CultureTreated Microplates with Lid, , DO test kit, 250 tests, 0.5-8 ppm ,mg per L , pH test kit, 250 tests, pH 4-10 , Total Alkalinity test kit, 300 tests 5-100 and 25-500 ppm ,mg per L , Carbon dioxide test kit, 300 tests 2-40 and 10-200 ppm mg per L , Ammonia test kit, 250 tests, 0.05-8 ppm mg per L , TRIzol Reagent - 200 ml , DO test kit, 250 tests, 0.5-8 ppm mg perL , pH test kit, 500 tests, pH 6-9 , Carbon dioxide test kit, 300 tests 2-40 and 10-200 ppm ,mg per L , Total hardness test kit, 500 tests 5-100 and 25-500 ppm ,mg per L , Ammonia test kit, 250 tests, 0.05-8 ppm ,mg per L , Nitrite test kit, 400 tests, 0.25-5.0 ppm ,mg per L , Petroleum Ether 40-60 C, Certified AR for Analysis, , Silpaulin 2350-400 GSM, 25x10 m , Air Pump 120 , Aquarium Oxygen Air Pump , Submersible biofilter pump , Submersible pump power head , Submersible Pump ,Power Head , Tullu Pump 220W ,.5-1 HP per 5 , Gate Valve brass , Submersible pond pump , Gate valv Tap 0.5 Inch , Silicon Aquarium air pip roll 500 mtr , Air stone rectangular ball 3 inch , air pipe joint , Small air stone , Silicon gun , Silicon tube , Ampicillin Dextrin Selective Supplement , Egg Yolk Tel Emulsion , SoyabeanCasem Digest Broth , Muller Hinton Agar , Coagulase Test ,Tubes , Rainbow Trout floating feed ,6mm. ICAR-DCFR developed and Licensed feed , Rainbow Trout floating feed ,3mm. ICAR-DCFR developed and Licensed feed , Rainbow Trout floating feed ,1.8mm. ICARDCFR developed and Licensed feed , Rainbow Trout floating feed ,1.2mm. ICAR-DCFR developed and Licensed feed , Soyabean Casein Digest Broth , Soyabean Casein Digest Agar , EC Broth , Durham Tubes , Screw tubes Round bottom , Metaloop CH-3 , Sterile Cotton Swab , Polypropylene cryogenic storage box , Freeze Tags Multicolor dots , Oxytetracycline , Benzalkonium chloride , Antioxidative activity ,TAC , ROS estimation kit , TBARS estimation kit , HiPer Protein Estimation Teaching Kit ,Quantitative , LDH estimation kit , S-GOT estimation kit , SGPT estimation kit , Alkaline phosphatase estimation kit , Nitro blue tetrazolium , Methanol , DMSO , Potassium hydroxide pellets , Sodium choride , Disodium dihydrogen phosphate , Potassium phosphate dibasic , Potassium phosphate monobasic , Potassium chloride , Trypsin , Trichloro acetic acid ,TCA , Sodium hydrogen carbonate , Epinephrine , EDTA , Hydrochloric acid , Hydrogen peroxide , 1-Chloro-2,4-dinitrobenzene , L Glutathione Reduced , Vanadium chloride , N-,1-Naphthylethylenediamine ,NEDD , Sulphanilamide , Sodium nitrite, , Nicotinamide adenine dinucleotide ,NADH , Sodium pyruvate , Butylatedhydroxytoluene ,BHT ,powder or solution in ethanol , 2-Thiobarbituric acid , Phosphoric acid , Diluent for DNA , Haematoxylin , Eosin , Alcian blue 8GX , Giemsa , Malachite Green , Bengal rose , Gram Stains - Kit , Toluidine Blue , Sudan Black , Xylene , DPX mountant , Acetone , Benzene , Sodium sulphate anhydrous , TrisHCl , Tris buffer , Paraffin wax
Supply of 20 Superoxide Dismutase Assay Kit 100 Assays Catalase Assay Kit Cat 100 Assays Glutathione Peroxidase Gsh Px Assay Kit 100 Assays Total Antioxidant Capacity Assay Kit 100 Assays Thiobarbituric Acid Reactants Tbars Assay Kit 100 Assays
