"नये भारत का नया Tender Portal"
Request a call back

Tender Summary #35610475

Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5

  • Sector: Education And Research Institutes
  • Location: Uttaranchal (Na*******)
  • Language: English
  • Submission Date: 03 Nov, 2025
  • Ownership: Central Government/Public Sector
  • Sector: Education And Research Institutes
  • Agency: Ind*******rch

Download Document