"नये भारत का नया Tender Portal"
Request a call back

Latest Tenders of central university of himachal pradesh

Total 108 tenders found
#TBR: 34550860 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 02 Jun, 2025 (0 Days Left)

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

Ref. Document
View Tender
#TBR: 34235324 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 25 Mar, 2025 (0 Days Left)

Supply Of Office Suite Software V2 Q2

Ref. Document
View Tender
#TBR: 34542718 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 03 Jun, 2025 (0 Days Left)

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

Ref. Document
View Tender
#TBR: 34527429 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 02 Jun, 2025 (0 Days Left)

Gem Bids For 1 Dslr Compact Handheld Camcorder Or Video Cameras V2 Q2

Ref. Document
View Tender
#TBR: 34442558 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 May, 2025 (0 Days Left)

Gem Bids For Autoclavable Bags , Culture Test Tubes With Autoclavable Caps Without Rim Borosilicate Glass , Conical Flask With Glass Stopper , Glass Tissue Culture Jars With Autoclavable Cap , Extraction Thimbles , Orchid Pots , Muslin Cloth , Test Tube Stand Aluminum , Sample Bags , Capillary Tubes , Crucible With Lid , Hand Made Herbarium Sheets , Herbarium Press , Dissection Box For Botany Practical

Ref. Document
View Tender
#TBR: 34434662 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 May, 2025 (0 Days Left)

Gem Bids For Zeatin Solution , Murashige And Skoog Medium With Sucrose And Calcium Chloride And Without Agar , Knudson Orchid Medium With Sucrose And Agar With Calcium Chloride , Scopoletin , P-hydroxybenzoic Acid , Linoleic Acid , Pcoumaric Acid , Beta Sitosterol , Sinapic Acid , Piperitone , Pcymene , Ethanol , Streptomycin Solution , Ascorbic Acid , Butylated Hydroxytoluene , Folin-ciocalteu Reagent

Ref. Document
View Tender
#TBR: 34353286 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 10 May, 2025 (0 Days Left)

Gem Bids For Rpmi1640 Medium. Hepes Modifcation With L Glutamine And 25mm Hepes Without Sodium Bicarbonate Powder Suitable For Cell Culture , Fetal Bovine Serum Non-usa Origin Sterile Fltered Suitable For Cell Culture , Ethanol Absolute. For Analysis Emparta Acs , Trypsin From Porcine Pancreas Lyophilized Powder Bioreagent , Thiazolyl Blue Tetrazolium Bromide Powder Bioreagent Suitable For Cell Culture Suitable For Insect Cell Culture , Trypan Blue Solution , Corning Syringe Flters , Lb Broth With Agar , Lb Broth Miller Highlyreferenced Nutrient-rich Microbial Growth Powder Medium Suitable For Regular E Coli Culture , Ethylene Glycol Analytical Standard , Ethylenediaminetetraacetic Acid Acs Reagent , Zinc Acetate , Polyvinylpyrrolidone Mol Wt Number Average Molecular Weight , Gadolinium Iii Nitrate Hexahydrate , Chromium Iii Nitrate Nonahydrate , Cadmium Chloride , N N Dimethylformamide Acs Reagent , I Sodium Citrate Anhydrous Emprove Essential , Ascorbic Acid , Hydrogen Peroxide Solution , Hydrazine Hydrate Solution , Tetra-nbutyl Orthotitanate , Ferric Nitrate Nonahydrate , Magnesium Nitrate Hexahydrate , Samarium Iii Nitrate Hexahydrate , Acetic Acid , Poly Vinyl Alcohol Pva , Samarium Iii Oxide , Niobium V Oxide , Molybdenum Iv Oxide , Samarium Powder For Synthesis , Cobalt Ii Chloride Anhydrous , Nickel Ii Chloride , Lithium Chloride , Hydrofluoric Acid , Silver Nitrate Solution , Ammonium Hydroxide Solution , Silicon Nanoparticles

Ref. Document
View Tender
#TBR: 34278450 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 16 Apr, 2025 (0 Days Left)

Gem Bids For Potassium Hydroxide 1000 G , 4 Percent Paraformaldehyde 500 Ml , Phenol Chloroform Isoamyl Alcohol 300 Ml , Sodium Carbonate 500 G , Thiobarbituric Acid 125 G , Sodium Hydroxide 1000 G , Superoxide Dismutase Antioxidant Assay Kit Calorimetric 1 , Riboflavin 100 G , Trypan Blue Zero Point Four Percent Solution 50 Ml , Guaiacol 250 G , Iron Chloride Fecl3 100 G , Potassium Ferricyanide 100 G , Iodine 100 G , Dichloromethane 100 Ml , Iron Sulfate Feso4 500 G , Sodium Hypochlorite Naocl 500 Ml , Perchloric Acid Hclo4 500 Ml , Zinc Chloride Zncl2 500 G , Sodium Iodide Nai 500 G , Phosphate Buffer 500 Ml , Dna Extraction Kit For Animal Tissue 2 , Pcr Kit 2 , Pbs Phosphate Buffered Saline 1000 Ml , Sodium Chloride 1000 G , Bouins Fixative 500 Ml , Bradford Reagent 1000 Ml , Alt Activity Kit Calorimetric 50 Rxn , Ast Activity Kit Calorimetric 50 Rxn , Alp Activity Kit Calorimetric 50 Rxn , Giemsa Stain 50 Ml , Ethanol 15 L , Nitroblue Tetrazolium Nbt 25 G , S Acetylthiocholine Iodide 25 G , Potassium Cyanide 500 G , Drabkins Reagent 500 Ml , Hayemis Rbc Diluting Fluid 100 Ml , Turks Wbc Diluting Fluid 100 Ml , Heparin Anticoagulant 50 Ml , Hydrogen Peroxide 1500 Ml , 1 Chloro2 4 Dinitrobenzene Cdnb Ar 100 G , Glutathione Reduced Gsh 25 G , Two Point Five Percent Glutaraldehyde 500 Ml , Diethyl Ether Ar 1000 Ml , Petroleum Ether Ar Grade 2500 Ml , Pyrogallol 100 G , Nitric Acid 1000 Ml , Perchloric Acid 1000 Ml , Glacial Acetic Acid 1500 Ml , L Tryptophan Extrapure 100 Mg , Barium Chloride Dehydrate 500 G , Gum Acacia 500 G , Magnesium Chloride Hexahydrate 500 G , Potassium Nitrate 500 G , Methyl Cellosolve 1000 Ml , Citric Acid 500 G , Sodium Citrate Tribasic Dehydrate Extrapure 98 Percent 500 G , Anthrone Acs 98 Percent 25 G , N Propanol 1000 Ml , Ammonium Metavanadate 100 G , Phenol Crystalline Extrapure Ar 500 G , Boric Acid 500 G , Papain 100 G , Ferric Chloride Hexahydrate A 100 G , Starch 1000 G , Donepezil Hydrochloride 1 , Master Mix Pcr 100 Rxn , Dpph 2 G , Atbs 5 G , Ctab 3 Kit , Mcnkey Broth 500 G , Mha Muller Hinton Broth 500 G , Sterile Disc 2 Pack , Plate Count Agar 500 G , M17 Agar 500 G , M17 Broth 500 G , Ox Bile Ox Gall 500 G , Mha Agar 500 G , Mrs Broth 1000 G , Mrs Agar 1000 G , Pepsin And Cysteine 25 G Each , X Gal 5 Bromo 4 Chloro 3 Indolyl Beta D Galactopyranoside 1 G , 10 Micro Leter Iptg Iso Propylthio Beta D Galactopyranoside 5 G , Columbia Agar 500 G , Dna Extraction Kit For Bacteria 1 Pack , Molecular Primer 27f 5agagtttgatcctggctcag 3 And 1492r 5 Tacggtaccttgttacgactt3 , Wurster Reagent N N N N Tetramethyl Pphenylenediamine 10 G , Sucrose Lactose Maltose Glucose Fructose Xylose Sorbitol 500 G Each , D Arabinose 100 G , D Reffinose 100 G , Gram Staining Kit 200 Ml Reagents , Trypsin 10 G , Nutrient Agar 500 G , Nutrient Broth 500 G

Ref. Document
View Tender
#TBR: 34678103 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 23 Jun, 2025 (0 Days Left)

Gem Bids For Bus Hiring Service - Regular Basis - Local; 37-39; Non Deluxe Ndx; 150

90.00 Lacs
View Tender
#TBR: 34274211 Closed

Education And Research Institutes

  • Himachal Pradesh
  • Due On: 24 Apr, 2025 (0 Days Left)

Gem Bids For Platinum Coated Silicon Wafer , Titanium Target , Zinc Target , Cobalt Target , Titanium Pellets , Zinc Pellets , Cobalt Pellets , Alumina Ceramic Boat Crucible , Alumina Ceramic Crucible , Thin Films Sample Box , Silver Paste , Fto Substrates , Ito Substrates , Nickel Foam , Carbon Cloth , Quartz Tubes , Kimwipes Disposable Wipers , Silica Gel

Ref. Document
View Tender
Download Document