"नये भारत का नया Tender Portal"
Gem Bids For One Three Dinitrobenzene, 2 2 Azino Bis 3ethylbenzothiazoline 6 Sulphonic Acid Abts, 2 Propanol, 35 Dimethoxy 4 Hydroxyacetophenone Acetosyringone, Acetone, Acetic Acid Glacial, Acetonitrile, Acrylamide, Activated Charcoal Powder, Aluminium Potassium Sulphatedodecahydrate Potash Alum, Ammonia Solution Ammoniumhydroxide, Ammonium Chloride, Ancymidol, Andrographolide, Bismuth Iii Subnitrate, Bromine Water, Bromocresol Green, Bromocresol Purple, Carboxymethylcellulose Sodium Salt, Chitin, Chitosan, Chloroform, Citricacid Monohydrate, Curzerenone, Dextrose D Plus Glucoseanhydrous, Diethylene Glycol, Dmso, Dpph 2 2 Diphenyl 1picrylhydrazyl, Dragendorff S Reagent, Ethanol, Ethylacetate, Ethylene Glycol, Ferrous Chloride Tetra Hydrate, Formaldehyde, Glycerol, Hydrochloric Acid, Hydrogenperoxide, Hyperoside, Jasmonic Acid, Lactic Acid, Lascorbic Acid, Litmus Solution Blue, Litmus Solution Red, Luria Bertani Agar Miller Miller Luria Bertani Agar, Luriabertani Broth Miller Miller Luria Bertani Broth, Mercuricchloride, Methanol, Methyl Orange, Methyl Red, Millonsreagent, Molisch Reagent, Mueller Hinton Agar, Muellerhinton Broth, Murashige And Skoog Media Wcacl2 Andvitamins And Sucrose Wo Agar, Murashige And Skoogmedium W Cacl2 And Vitamins Wo Sucrose And Agar, Murashige And Skoog Microelements Solution 100x, Murashige And Skoog Vitamins 1000x, Murashige Andskoogmacroelements Solution 10x, N Butanol, Neoandrographolide, N Hexane, Ninhydrin, Nitric Acid, Npropanol, Paclobutrazol, Perchloric Acid, Petroleum Ether, Phenol Crystal, Phenolphthalein, Potassium Dichromate, Potassium Iodide, Potassium Permanganate, Quercetin, Rottlerin, Silica Gel G For Tlc, Silver Nitrate, Sodiumbicarbonate, Sodium Bisulphite, Sodium Carbonateanhydrous, Sodium Chloride, Sodium Hydroxide, Sodiumlactate, Sodium Nitroprusside Solution, Sucrose, Sulphuricacid, Tartaric Acid, Toluene, Tween 80, Universalindicator Solution, Wagner Reagent, Xylene, Agarose, Ammonium Acetate, Ammonium Persulphate, Isoamylalcohol, Boric Acid, Bromophenol Blue, Coomassie Briliantblue, Ctab N Cetyl N N N Trimethylammonium Bromidebuffer, Dna Polymerase With Standard Taq Buffer With Mg2plus, Dntps, Ethidium Bromide, Polyvinylpyrrolidone, Temed, Tris Hcl, Xylene Cyanol, Urea, Acryl 29 Ratio 13dot 3 Cross Linker, 10x Tbe Solution, Phenol, Mgcl2, Dnaladder, Protein Markers, Primers Forward N Reverse, Plantgenomic Dna Isolation Teaching Kits, Rna Extractionteaching Kits, Pcr Teaching Kits, Diphenyl Amine Reagent, Saline Citrate Buffer Ph 7, Depec Water, Rna Ladder, Dna Amplification Universal Primers, Diluent For Dnaextraction
Supply Of Taq Dna Polymerase Recombinant
Gem Bids For Dulbeccos Modified Eagle Medium D, Sure Fetal Bovinesera Gamma Irradi, Penicillin Streptomycin Neomycin So, Trypsin Edta Solution, 10x Pbs Ph, Syringe Driven Filters, Ezdetect Pcr Kit For Mycoplasma Det, Cryovials Externallythreaded 2ml, Dimethyl Sulphoxide Dmso, Trypan Bluesolution In Dulb, Tissue Culture Flask Vented Cap 25, Tissue Culture Flask Vented Cap 2, Cell Culture Scaffold6well Plate, Tissue Culture Plates 96 Well, Steriledisposable Petri Platespol, Disposable Serological Pipettes5m, Disposable Serologlcal Pipettes 10, Disposableserological Pipettes 25, Taq Polymerase 5 Units Ul, Hitemp Dna Polymerase, 100bp Dna Ladder, Agarosespecial Low Eeo, Hisy8r Safe Gelstain 10000x In D, Hipuraplasmid Dna Miniprep Purific, Hipura Dhs Competent Cells, Luria Bertani Broth Milier Miller, Luria Bertani Agarmodified, Ampicillin Sodium Salt Rant Cultur, Minimumessential Medium Mem, Hisybr Master Mix With Tagpolymer, Oligonucleotides, Hicdna Synthesis Kit, Molecular Biology Grade Water, Paraformaldehyde, Tritonx100, Bovine Serum Albumin, Goat Serum Sterile Filtered, Dapi Dihydrochloride, Barrier Tips Max Capacity 10ul, Barrier Tips Max Capacity 200ui, Barrier Tips 1000ul, Centrifuge Tube15ml Orange Cap, Centrifuge Tube 50 Miorange Cap, Micro Centrifuge Tube B Attached, Pararfilmdm 125 Thermoplastic Colou, Kimwipes, Diluent For Dnaextraction, Disposable Masks, Hi Disposable Bag 14clear, Carbapenemase Gene Multiplex, Hipura Bacterial Genomicdna Purific, Pcr Blocks Non Skirt Natural Sterile, Pipettetips Yellow 200, Human Il6 Elisa Kit, Insulin Elisa Kit, Faecal Calprotectin
Gem Bids For Sh30068.03hi Fbs Chardex Treated Us 500ml Hi , M0491s Q5 High Fidelity Dna Polymerase 100 Units , 27104 Qiaprep Spin Miniprep Kit 50 , Pg Pmt2922 3 Color Prestained Protein Ladder, 10 To 250kda 2x250ul , Sh30042.02 Trypsin 500ml , Pg 40005 Puregene Quick Dissolve Agarose 500g , Sh30243.02 Lm Dmem High Wpyr 1000ml , 8235s Annexin A2 D11g2 Rabbit Mab 100 Ul , 2267s Rpa70 Rpa1 Antibody 100 Ul , 3030 681 3mm Chr 15cmx100m 1rl Pk
Gem Bids For M0531s Phusion High Fidelity Pcr Master Mix With Hf Buffer 100 Reactions , M0491s Q5 High Fidelity Dna Polymerase 100 Units , 96 001 01 Esf 921 Insect Cell Culture Medium Protein Free 1l Bottle 2 To 8 Deg C Ambient , Pg Pmt2922 3 Color Prestained Protein Ladder 10 To 250kda 2x250ul , 5366s Anti Rabbit Igg H Plus L Dylight 680 Conjugate 500 Ul , A63880 Ampure Xp Beckman Coulter , M0264l Recjf 5000 Units , 345829 Quick Seal Polypropylene Bell Top Centrifuge Tube 2ml With Seal Former Tube Sealer , N0447l Deoxynucleotide Dntp Solution Mix 40 Umol , Mo202l T4 Dna Ligase 100000 Units
Gem Bids For Kimwipes Disposable Wipes, Screw Cap Centrifuge Tuberound Bottom Pp30, Parafilm, Maxiamp Pcr Tubes 0point 2, Maxiamp 0 Point 2ml Tube Strips With Cap, Non-skirted 96 Wells Standard Profile Pcr Plate, Siliconesealing Mat For Plates, L Shaped Spreader Sterile, Selfstanding Centrifuge Tube Amber, Epicatechin Gallate Ecg, Epicatechin Ec 1mg Hplc Grade, Epigallocatechin Egc 5mghplc Grade, Epigallocatechin Gallate Egcg, Gallocatechingc, Catechin Gallate Cg, Gallocatechin Gallate Gcg, Ultracentrifugal Filter 3 Kda Mwco, Ultra Centrifugal Filter 30kda Mwco, Ultra Centrifugal Filter 50 Kda Mwco, Delicatedisposable Wipes, Weighing Boat Small 43 X 58 X 13 Mm, Weighing Boat Medium 83 X 132 X 26 Mm, Weighing Boatlarge 108 X 183 X 26 Mm, Dntp 100mm Set 4x25 Umolpoint 25ml, Taq Dna Polymerase, Rnasezap Rnasedecontamination Solution, Trizol Reagent, Ultrapureagarose, Platinum Taq Dna Polymerase, 10x Tbebuffer, Hygromycin B, Hypersep Aminopropyl Cartridge, Guide-it Mutation Detection Kit, Qi Aquick Pcr Purificationkit 250, Qiaprep Spin Miniprep Kit 250, Bsai Hfv2, Sali Hf, Bglii, Bsmbi V2, Ecorv Hf, Ecori Hf, T4 Dna Ligasereaction Buffer, T4 Dna Ligase, T4 Polynucleotide Kinase, Q5 Hot Start High Fidelity Dna Polymerase, Spectrum Planttotal Rna Kit Fastrna Pro Green Kit Mp Bio, Kimberly Clarkkimtech 9 5in S Size Food Grade Purple Nitrile Exam Gloveskc, Kimberly Clark Kimtech 9 5in M Size Food Grade Purplenitrile Exam Gloves Kc, Kimberly Clark Kimtech 9 5in L Sizefood Grade Purple Nitrile Exam Gloves Kc, Supelclean Lc18 Spe Tube Bed Wt 500 Mg Vol 3 Ml, 6 Y Ydimethylallyalamino Purine 2ip Riboside, Mops, Gelrite, Gamborg B5 Medium, Murashige And Skoog Medium, Reagent Bottles Wide Mouth With Screw Cap Square, Culturetubes Round Bottom Clear With Pp Cap, Filter Flask Withglass Tubulation //bid Details2 / 54
Gem Bids For Bead Pro Tubes 2ml 50 Reaction, Shredder 250 Reaction, Magnetic Beads For Nucleic Acid Purification 400 Ml, Dnacleanup Kit For Environmentalcomplex Samples 50 Reaction, Twist Universal Adapter System Truseq Compatible 96samples Plate, Ampure Pb Bead Size Selection Kit, Highmolecular Weight Dna Extraction Kit 96 Reaction, Inhibitorremoval Kit 50 Reaction, 100 Bp Dna Ladder Ready To Use50 Ugml 125 Lanes, 1 Kb Dna Ladder 50 Ugml 125 Lanes, Repair Mix For Ffpe 96 Reaction, Recombinant Albuminmolecular Biology Grade 12 Mg, Dna Repair Mix 150reaction, Gel And Pcr Clean Up Kit 250 Reaction, Wholegenome Amplification Kit 50 Reaction, Multipledisplacement Amplification Kit 100 Reaction, Exonucleasesap Reagent 500 Reaction, Nucleic Acid Purification Kit Forsequencing 250 Reaction, Hot Start Dna Polymerase 200 U, Kits For Hmw Dna Extraction From Animal Tissues 24reactions, Reagents To Complete Depletion Size Selection Ofdna 10 Kb, Reagents To Complete Depletion Size Selectionof Dna 25 Kb /bid Number: Gem/2025/b/6830234* /dated: 28-10-2025 & & / Bid Document1 / 23
Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5
Gem Bids For Chemical, Phenol 500Gpk, Goat Anti Bovine Igg H L Secondaryantibody Hrp, Sheep Anti Bovine Igm Secondary Antibodyhrp 1Mg Pk, Gelatin From Bovine Skin 500G Pk, Protein Gperoxidase From Streptococcus Sp 250Ug Pk, Ophenylenediamine Dihydrochloride 100Tab, Rb 2X Taq Pcrmaster Mix Premix Taq Dna Polymerase With Dntps Andbuffer With Green Dye 500Rxn, Anti Human Igg Fe Specificperoxidase Antibody Produced In Goat 1Ml Pk, Anti Humanigm U Chain Specific Peroxidase Antibody Produced In Goat1ml Pk
Gem Bids For Molecular, Taq Polymerase, 1kb Dna Ladder, Parafilm, Cryo Storagebox, Deferoxamine 20mg
