Gem Bids For Ornamental, Itaq Universal Onestep Rt Qpcr Kit With Sybergreen, Iscript Advanced Cdna Synthesis Kit 25X20ul Rxns, 5Mcdna Elisa Kit, Whole Genome Bisulphite Sequencing, Lactobacillus Plantarum Lyophilized Powder, Bacilluslicheniformis Lyophilized Powder, Oxytetracycline, Sodiumascorbate Powder, Food Grade Egg Albumin Powder, Cloveoil, Sodium Percarbonate Tablets, Probiotic Commercialpreparations For Fish Feed Application, Larviva, Cod Liveroil, Sodium Chloride, Astaxanthin Powder, Carotenoidpowder, Spirulina Algal Powder, Whole Genome Bisulfitessequencing
Gem Bids For Boq, Triamcinolone Acetonide Injection Ip 40 Mg Ml Preservativefree For Intraocular Use, Indocyanine Green For Inj Usp 25Mg Sterile Lyophilized Powder, Riboflavin Kit For Collagencross Linking, N-Butyl Cyanoacrylate 0 Point 5Ml Inj, Tropicamide With Phenylephrine With Lidocaine Forintracameral Use 1 Ml, Inj Sodium Chondroitin Sulphate 40Mg Plus Sodium Hyaluronate 30 Mg In 0 Point 75 Ml
Gem Bids For Inhaler Formoterol 6 Mcg Plus Budesonide 100 Mcgbottle Of 120 Metered Dose, Paracetamol 250 Mgper 5 Ml 60 Ml Per Bottle, Tablet Voglibose 0 Point3mg, Tablet Chlorpromazine Hcl 50mg, Drop Eyepilocarpine Nitrate 2percent Minimum 5ml Per Bottle, Injection Tigecycline 50mg Lyophilized Powder
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Custom Dna Synthesis Of Primers 25 Nmol , Prime Script 1st Strand Cdna Synthesis Kit 50 Reactions , Tb Green Pre Mix Ex Taq Ii Tli Rnase H Plus , Rnaiso Plus Total Rna Extraction Reagent , Amylase From Bacillus Licheniforms , Amyloglucosidase From Aspergillus Niger Lyophilized Powder 70 U Mg , Glucose Oxidase Form Aspergillus Niger Type Vii Lyophilized Powder 100000 Units G Solid Without Added Oxygen , Peroxidase From Horseradish Type Ii Essentially Salt Free Lyophilized Powder 150 250 Units Mg Solid Using Pyrogallol , Primers Forward Revers Total Base 1249 , Fish Immunoglobulin M Ig Elisa Kit 96t , Superoxide Dismutase Sod Elisa Kit , Fish Lysozyme Renal Amyloidosis Lzm Elisa Kit , Fish Interleukin 6 Il 6 Elisa Kit , Fish Cortisol Elisa Kit , Forward Primers , Reverse Primer , Taq Dna Polymerase , Ezassay Antioxidant Activity Estimation Kit Cuprac 200 Tests , Azo M Protein Azo Casein , Ezdetect Pcr Kit For Mycoplasma Detection Based On 16s 23s Rrna Spacer Region , Trypsin Inhibitor Powder Source Soyabean Cell Culture Tested Activity 7000baee Units Of Inhibition Mg , Coif1 5tcaaccaaccacaagacattggcac3 26 Nucleotides , Coir1 5tagacttctgggtgccaaagaatca3 26 Nucleotides , M151 5aacccggctttcggcagca3 20 Nucleotides , M152 5cggggcggggttgtgagat3 20 Nucleotides , Ihn Up F 5agagatccctacaccagagac 3 21 Nucleotides , Ihn Up R 5agagatccctacacagagac 3 21 Nucleotides , Vn F 5atggaaggaggaatcgtgaagcg 3 24 Nucleotides , Vn R 5
Gem Bids For Onco, No 2 Obq 0 Monofilament Polydioxanone Pds Suture Violet70 To 80Cm 1 Obq 2 Circle 30 To 40Mm Round Bodied Needlebis Box Of 12 No 3 Obq 0 Monofilament Polydioxanone Pdssuture Violet Length 70 To 80Cm 1 Obq 2 Circle 30 To 40Mmround Bodied Needle Box Of 12 No 4 Obq 0 Monofilamentpolydioxanone Pds Suture Violet Length 70 To 80Cm 1 Obq 2Circle 20 To 25Mm Round Bodied Needle Box Of 12 No 5 Obq0 Monofilament Polydioxanone Pds Suture Violet Length 40To 50Cm 15 To 20Mm 1 Obq 2 Circle Round Body Needle Bisand Equivalent Box Of 12 Black Braided Silk Withneedle Suture 3 Obq8 Circle Reverse Cutting 45 Mmlength 76 Cm Size 2 Obq 0 Pack Of 12 Obqbox Usfda Synthetic Absorbable Polyglactin Coated 1 Obq2circle Round Body 16 Mm Braided Length 70 Cm Size 4 Obq0 Pack Of 12 Obqbox Usfda Skin Marking Pen Thickmarking With A Flexible Scale Sterile Peel Open Pouch Vascular Tapes Red Vascular Tapes Blue Monofilamentpolyglecaprone Absorbable Suture Size 3Obq 0 70 To 90 Cm1 Obq2 Circle Taper Cutting 20 To 30 Mm Needle Eu Bis Andequivalent Box Of 12 Aami Level 3 Reinforcedperformance Sterile Surgical Gown Consists Of Five Layersfsms Fabric With Two Hand Towel Bipolar Disposablecautery Leads Vascular Chemport 9Point6 Fr Mricompatible With One Way Valve With Introducer Kit Bovinecollagen Patch Coated With Synthetic Sealant Nhs Peg 27Mmx27 Mm Bovine Collagen Patch Coated With Syntheticsealant Nhs Peg 45 Mmx45 Mm Monopolar Handswitchingdisposable Sterile Pencil Disposable Sterile Monopolarcautery Leads Plug Connector 3 Pin Banana Plug Control Basic Drape Pack Disposable Sterile Drape Set For Head Andneck Surgeries Breast Prosthesis External Silicone Teardrop Shaped With Under Arm Extension In Light Weight Ariantassorted Sizes With Two Bras Having Two Pouches Each Bid Number Gem2025b6692939 Dated 11-10-2025 Bid Document1 46 0 0 Linear Cutter Stapler 60Mm With Interchangeable Cartidgesto Accommodate And Use Different Colour Reloads Withtristaple Technology, Linear Cutter Stapler 80Mm Withinterchangeable Cartidges To Accommodate And Usedifferent Colour Reloads With Tristaple Technology, Linearcutter Stapler Reloads With Inbuilt New Knife And With Threedifferent Leg Length 3Point0mm 3Point5mm And 4Point0mmstaple Lines, Reusable Clip Applicator For Open Surgerycompatible With Ligaclip 300, Reusable Clip Applicator Foropen Surgery Compatible With Ligaclip 400, Titanium Linearcutter 75Mm Selectable Staple Height Of 1Point5 To 1Point82point0mm Titanium Mri Compatible In One Cartridge, Circular Wound Protector Obqretractor With Flexibleretraction Ring Small Incision Size 2Point5 To 6 Cm Pack Of 5, Closed Wound Suction Drain Unit With 02 X Perforated Pvcdrain With 01 Trocar 01 Spring Loaded Bellows Andconnecting Tubing Size 12 Fr, Breathabe Reinforced Highperformance Aami Level 4 Sterile Surgical Gown Soft Knittedv Neck Collar Consists Of Five Layer Sfsms Non Woven Fabric, Universal Pack Minor With Short Side Drapes Containing Topdrape 276Cm X 149Cm Bottam Drape 165Cm X 193Cm Sidedrape 2 83Cm X 114Cm, Universal Pack Contain 1 Outerwrap 90 Cm X 90 Cm 1 Suture Bag 1 Bottom Drape Withcontrol Reinfrocement 193 Cm X 193Cm 1 Top Drape, Greenreloads 2Point0mm Close Staple Height With Gripping Surfacetechnology Compatible With Present Powered Stapler 45Mm, Powered Vascular Stapler 35 45Mm With Narrower Curvedand Blunt Tip Anvil With Thinner Shaft Offering Greatest Angleof Reach, Double Lumen Pvc Plastic Tracheostomy Tube Withlow Pressure Cuff And Speaking Valve With 360 Degreefreedom At Neck Flange Size 7Mm Id, Double Lumen Pvcplastic Tracheostomy Tube With Low Pressure Cuff Andspeaking Valve With 360 Degree Freedom At Neck Flange Size7point5 Mm Id, Double Lumen Pvc Plastic Tracheostomytube With Low Pressure Cuff And Speaking Valve With 360Degree Freedom At Neck Flange Size 8Mm Id, Knotlesstissue Control Device Synthetic Absorbable Polydioxanonewith Antibacterial Triclosan Coated 1 Obq2 Circle Taper Point26mm Unidirectional, Knotless Tissue Control Device 1 Obq2circle Taper Point Sh26 Mmpolydioxanone Withtriclosan Unidirectional With Fixation Tab 45Cm Size 3 Bq0, Knotless Tissue Control Device Synthetic Absorbablepolydioxanone With Antibacterial Triclosan Coated 1 Obq2circle Taper Point 40Mm Unidirectional With Fixation Tab45cm Size 1 Box Of 12, Laparotomy Drape With Incise76inpoint X 120 In 193Cm X 305Cm Fenestration Having Smscontrol Plis Fabric Reinforcement Meets The Ammi, Laparoscopic Endobag Retrieval Device Large 300 Ml, Laparoscopic Endobag Retreival Device Medium 200 Ml, Laparoscopic Disposable Veress Needle 120Mm, Moldableskin Barrier Hydrocolloid Flexible Collar Colostomy Obqurostomy Set Cinsist Of Wafer 10 Nos Flange 10 Nos Stomapaste 02 Powder 01 Belt 01 Size 57 Mm, Moldable Skinbarrier Hydrocolloid Flexible Collar Colostomy Obq Urostomyset Cinsist Of Wafer 10 Nos Flange 10 Nos Stoma Paste 02Powder 01 Belt 01 Size 70 Mm, Polyglyconate Absorbableunidirectional Barbed Suture 3Obq 0 17Mm Taper Point 1Obq2 Circle 15Cm Box Of 12, Polyglyconate Absorbableunidirectional Barbed Suture 2 0 26Mm Taper Point 1 Obq2circle 30Cm Box Of 12, Single Lumen Pvc Plastictracheostomy Tube With Low Pressure Cuff Size 7Point0 Mmid, Single Lumen Pvc Plastic Tracheostomy Tube With Lowpressure Cuff Size 7Point5mm Id, White Reload 1Point0mmclose Staple Height With Gripping Surface Technology //Bid Details2 / 46 Compatible With Present Powered Stapler 60Mm, Sterilepowder Free Latex Micro Surgical Gloves Iso Obqen Obqastmcertified Viral Resistance Tested Light Brown Size 7Point0, Reusable Insulated Smoot Tip Stainess Steel Foot Switchingbiopolar Coagulation Forceps Hardy Bayonet Forceps Withstops 20Point9 Cm 8Point25, Reusable Insulated Smoot Tipstainless Steel Foot Switching Bipolar Coagulation Forcepssemkin Forceps With Stops 14Cm 5Point5 In Tip 0Point5mm, Disposable Automatic And Semi Automatic Core Biopsy Gun12gx10 And 16Cm Length With A Dual Adjustable Penetrationdepth Of 18Mm, Disposable Automatic And Semi Automaticcore Biopsy Gun 14G X10 And 16 Cm Length With Adjustablepenetration Depth Of 18 Mm And 25 Mm, Disposableautomatic And Semi Automatic Core Biopsy Gun 16Gx10 And16cm Length With A Dual Adjustable Penetration Depth Of18mm And 25Mm, Disposable Automatic And Semiautomatic Core Biopsy Gun 18G X10 16 And 20 Cm Lengthwith Adjustable Penetration Depth Of 18 Mm And 25 Mm, Incise Drape Made Up Of Polyester Film With An Acrylicadhesive That Contains A Complex Of Iodoform N Vinyl 2Pyrrolidine With A Iodine Concentration, Sterile Indocyaninegreen Usp 25 Mg Lyophilized Powder For Iv Obq Intraocularuse Vial And 5 Ml Sterile Distilled Water With Sterile Singleuse Syringe Filter 0Point2 Micron, Polyamide Monofilamentsize 3 Obq0 70 100Cm 3 Obq8 Circle Reverse Cutting 2530Mm Box Of 12 Foils, Synthetic Oxidized Re Generatedcellulose Double Layered With Peg And Trilysine Size 2 Into 4Cm, Synthetic Oxidized Re Generated Cellulose Doublelayered With Peg And Trilysine Size 5 Into 5 Cm, Syntheticoxidized Re Generated Cellulose Double Layered With Peg Andtrilysine Size 5 Into 10 Cm
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Supply Of Running Contract For Inj.lyophilized Powder Contains Follitropin Alfa Recombinant Dna Follicle Stimulating Hormone 75 Iu 5.5mcg In Vial Packing..
Gem Bids For Span80, Tannic Acid, 6 Aminocaproic Acid, Rpmi1640medium, With Glutamine, Mem Eagle At017, Hyaluronic Acid, Calcium Chloride Fused L R 500gm, Dextrin White, Dextran From Leuconostoc Sp, Minocycline Hydrochloride, Span 80, Acetic Acidglacial, Glycerine, Paraffin Liquid Light, N-hexane, Toluene, Bovine Serum Albumin, Paraformaldehyde, Collagenase From Clostridium, Pepsin Lyophilized Crystalline Powder
Supply Of Itab. Telmisartan 40 Mg + Amlodepin 5 Mg +chlorthalidone 6.25mg Iitab. Methylcobalamine 1500 Mcg. Iiitab/cap. Tacrolimus 0.25 Mg Iv Inj.vincristin 1 Mg Vinj. Bendamustine Ip 100mg Lyophilized Inj. Bendamustine Ip 100mg Lyophilized Powder.